ATGATTAACTCCTGTATAGAAAATTGTGAAGCCAGGGAGACCCATGAAGCAAATTCATGGGAGAGATCGTGA

My Thesis Work

Lab
According to my advisor: Our laboratory is interested in understanding the relationship between genomic change and the creation and divergence of species. Much of our current research investigates the evolutionary origins and developmental mechanisms of reproductive isolating mechanisms between species, such as hybrid sterility and lethality. We are currently using diverse approaches including developmental genetics, biochemistry, molecular evolution and population genetics, and comparative genomics to investigate interspecific hybrid lethality in the fruitfly DrosophilaClick here for more info.

Project

For my thesis work, I have been studying the interactions and properties of the gene Lethal hybrid rescue (Lhr).  We have demonstrated that LHR is a chromatin-associated protein, and predominantly localizes to heterochromatin.  By using both genetic and molecular biological approaches, I have found that Lhr is closely associated with Heterochromatin Protein 1 (HP1) and also interacts with other heterochromatin proteins (HPs).  I am also currently trying to address the role of many of these HPs in the hybrid lethal function of Lhr.  If you would like to know more, or want some specifics, just get a hold of me and I’m sure I’ll talk your ear off about it.

Publications

Brideau, N. J.*, Flores, H. A.*, Wang, J.*, et al. (2006). Two Dobzhansky-Muller genes interact to cause hybrid lethality in Drosophila. Science, 314, 1292-5.

Other articles in Nature, Science 1, 2 and Current Biology about our paper.

Whitlock KE, Illing N, Brideau NJ, Smith KM, Twomey S. (2006) Development of GnRH cells: setting the stage for puberty. Molecular and Cellular Endocrinology, 254-255, 39-50.