ATGATTAACTCCTGTATAGAAAATTGTGAAGCCAGGGAGACCCATGAAGCAAATTCATGGGAGAGATCGTGA

Surströmming

November 17th, 2008 Posted in cool stuff | 2 Comments »

Or “soured herring” is a Northern Swedish delicacy consisting of fermented Baltic herring.  I actually thought it meant “canned fish that smells like death”.  Thanks to Anders, a former postdoc in Chelsea’s lab we got to try this famous dish.

Anders specially packaged this container and brought it here from Sweden just for us to enjoy with him.  He was actually quite worried, because the cans are very pressurized due to the active bacteria inside, and the customs officers didn’t respect his careful packaging very much.  Actually its been rumored that some airlines have banned these cans from being taken aboard due to the possibility of explosion.

The cans are often opened either outdoors or underwater to lessen the smell, and protect the opener from being soaked in brine.  You can see the effect of the fermentation on the pressure above by the bubbles present in the water.

Here are the little fish packed in the can.  There were about 10-12 little herring in one can.  I know that doesn’t seem like much fish, but trust me that was more than enough for 5 people.

Sorry to disgust everyone, but I had to show the aftermath of the dissections.  Each fish has to be sliced open and the meat separated from the bones/carcass.  The roe is ok to eat, but the sperm should be avoided.  It took a little while to cut up each fish, but after that we were ready to put it together on a sandwich.

The sandwich consists of a small flat cracker (we used matzo crackers as a substitute for the real thing), which is then buttered.  Boiled potatoes were the next layer, followed by onion, and then finally the fish and a top cracker.  The fish was best used sparingly.  Also - pair with beer.

Here is a picture of Chelsea enjoying her first of three sandwiches.

I think everyone will agree with me that the smell packaged in these cans was horrible.  If I didn’t know this was a specialty dish there is no way I would have imagined it would be edible.  I would probably categorize it as a cross between dead mouse stuck in the attic and rotten fish.  As a pleasant surprise, it didn’t taste much like it smelled.  Ok - maybe a little bit, but the flavor is mostly salty fish.  Overall, I’m really glad that I had the opportunity to try this dish from another culture.  I would recommend it, or at least a small sandwich of it.  Thanks Anders.

This Old House: Designed to Sell

November 11th, 2008 Posted in This Old House | 2 Comments »

POST BY CHELSEA…

Ever since I bought my house, I have hated the wood “walls” in the dining room.  With a passion.  Not only are they outdated and just plain ugly but also, they aren’t even stained the same color on all four walls.  Not the best way to welcome potential buyers to their potential new home.

This was the site of the former dining room table (see previous post).  Lovely.

I think my favorite feature in this field of view is the high class fireproofing behind the wood stove.  Who doesn’t like unfinished mortarboard bolted to their wall?

And I don’t even know what to say about this one.  Wall to wall wood?  If that’s not a selling point, I don’t know what is.

Apparently, I complained enough about this room that Nick suggested we do something about it.  So, Sunday morning he brought up the idea of priming and painting the hated wood and Sunday afternoon we had one coat of primer and paint up on the walls.

It looks so much better already!!!

Today, the last coat of paint went on and the newly assembled dining room table (minus shattered top, of course) was introduced to its new home.

For a grand total of about four hours of work (including assembling the table), I think we made quite an impact.

Notice the horrible mortarboard is no longer bolted to the wall?  Although the rest of the room looks amazing, I think that is my most favorite little victory here.

And the wall to wall wood is gone too!

Now, all we have to do is finish the new coat closet in the other corner…

(edit by Nick: and put up crown molding and trim around the room)

But that’s a post for later:)

The $1 shipping bargain

November 11th, 2008 Posted in funny stuff | No Comments »

“HDS, sir!  And how are you this afternoon…alllllll-righty then.  I have a package for you.”

“sounds broken”.

“Most likely sir.  I bet it was something nice, though.”

This exchange is from one of my top 5 all time movies and applies directly to this post today.  After watching a number of HGTV programs such as “Designed to sell” we have slowly been accumulating ideas on how to best stage her house for potential sellers.  The first bit of advice was to get a new dining room table.  The rationale here is that we would get a smaller table to make the room look bigger.  Here is what the old table looked like:

The color did not match the rest of the room, and the size and shape were a little bit obtrusive.  An ad on craigslist and less than 12 hours later our problem was solved.  Once the old table was out of the way, we found the perfect new table online and especially loved the no tax and $1 shipping from overstock.com.

The new table arrived today in 3 separate boxes.  We immediately did like everyone does when they get packages at the door, find the first sharp utensil and rip open the boxes.  Here is what the large 40 pound box looked like:

Looking at the shapes of the boxes, it was clear that the glass top to the table was shipped in its own box.  We were both a little wary of what kind of delicate shipping we would get for the $1, and our fears were well justified.

These packages were shipped by UPS but it appears they were shipped TDS (Trebuchet delivery service).  If you think I wrote this entire post for that joke, you were right.  Actually I wanted a prelude to the next post which I should probably start writing.

Welcome to the world

November 4th, 2008 Posted in Uncategorized | No Comments »

Alexander Bradley White.

This cute little guy is the newborn son of my friends Geoff and Casey White.  I’ve known Geoff since we were just kids, and Casey for at least 6-7 years now and I can’t properly express how happy I am for the two of them.  They were the first of my close friends to take the plunge into marriage, and the trend continues for beginning their family.  I wish them all the best for their son.

“Lets Play a Game”

November 2nd, 2008 Posted in cool stuff | 1 Comment »

Our friends Ryan and Marie always go all out for halloween costumes and parties, and this year was no exception.  Here they are dressed up as Sweeney Todd and Mrs. Lovett:

Not ones to dissapoint, they also arranged a fun game for us when we arrived to their house for a halloween party.  I am going to detail it here, so this may be a long post.  Once everyone had arrived Ryan pointed to a bag that was hanging from the light fixture in the dining room.

For those of you familiar with the Saw series of movies this premise is very simple.  There is a tape, and a small player and the voice on the tape is a deep one, but all of the words are chosen for a reason and make some kind of story.

While we were all crowded around the table listening to the tape, Ryan successfully hid all our booze and locked the fridge shut.  The point of the game was to complete all the puzzles in order to finally get the key that will open the fridge.

Here is the first clue:  we have to stare at these pictures in order to find the next clue.  Finding the right combination shoud be as easy as childs play.  Not sure what that means, but somebody figured it out.

Here among the pile of dead babies and mangled animals was a small chest, with a combination lock.  We had to find the right numbers based on the pictures.  Once we did that there was another smaller box inside, that required yet another key.

We found the key behind the pictures, based on a replay of the tape and when we opened the box we found yet another tape.  This tape instructed us that we would have to make a sacrifice, and search for the key in some sort of code that was translated to: eat the jello brain mold on the table.

Lucky for us Jenn took the lead and mouthed the brain, took the first bite of jello.

Inside the brain was another key that opened this chest, which had yet audio clue and key.  This was a CD and relied on our memory.  The disc had a series of songs from scary movies of the past, and the when we listed the titles of the movies in order, the first letters spelled out the next clue.

After searching the basement we found a cooler, and when we opened it there was this and another tape.  A few of us didn’t bother listening to the tape, we knew what to do.  Nirav gutted that fish and pulled out the final key, and was then finally able to open the fridge and let everyone drink.

I think I speak for everyone when I say that this was a very clever and very fun game for halloween.  Thank you so much to our creative and always festive hosts  and Happy Halloween.